View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_15 (Length: 337)
Name: NF12700_low_15
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 127 - 318
Target Start/End: Complemental strand, 239341 - 239150
Alignment:
| Q |
127 |
cccttgcatcccttggtgcatatatgatgtacaatatgatgtagatggtctctaccacacatccaaatgagtttatggtaatgaggagaaaagcatcttt |
226 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239341 |
cccttgcatcccttggtgcatagatgatgtacaatatgatgtagatggtctctaccacacatccaaatgagtttatggtaatgaggagaaaagcatcttt |
239242 |
T |
|
| Q |
227 |
tttgagcaatgcatagtacaaccaaagcatggagctgaacaaagctactaggtaaggtagtgactgaaaaccctctgtcgatttcttcttgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239241 |
tttgagcaatgcatagtacaaccaaagcatggagctgaacaaagctactaggtaaggtagtgactgaaaaccctctgtcgatttcttcttgt |
239150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 127 - 318
Target Start/End: Complemental strand, 225324 - 225133
Alignment:
| Q |
127 |
cccttgcatcccttggt-gcatatatgatgtacaatatgatgtagatggtctctaccacacatccaaatgagtttatggtaatgaggagaaaagcatctt |
225 |
Q |
| |
|
||||||||||| ||||| ||||| || |||||||| |||||||| ||| |||||| || || ||||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
225324 |
cccttgcatcc-ttggtcgcatagattatgtacaagatgatgtaaatgagctctacgacgcacccaaaagagttaatggtaataaggagaaattcatctt |
225226 |
T |
|
| Q |
226 |
ttttgagcaatgcatagtacaaccaaagcatggagctgaacaaagctactaggtaaggtagtgactgaaaaccctctgtcgatttcttcttgt |
318 |
Q |
| |
|
||||||| |||||||| |||||||| |||||||| ||||| | || ||||| |||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
225225 |
ttttgaggaatgcataatacaaccacagcatggaactgaatagtgccactagataaggtagtgactgaaaaccctctgttgattttttcttgt |
225133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 239468 - 239432
Alignment:
| Q |
1 |
attcattgccgaaagtaacttgaaagttaagttctac |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
239468 |
attcattgccgaaagtaacttgaaagttaagttctac |
239432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University