View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_17 (Length: 325)
Name: NF12700_low_17
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 17 - 318
Target Start/End: Complemental strand, 26574452 - 26574151
Alignment:
| Q |
17 |
acaccggatatgtgagcaaccgatgaagctggatttagagactggaccatactattggctaacaaaatatccttcggaagattggaatttgaatgagtca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26574452 |
acaccggatatgtgagcaaccgatgaagctggatttagagactggaccatactattggctaacaaaatatccttcggaagattggaatttgaatgagtca |
26574353 |
T |
 |
| Q |
117 |
attgagaagtgcttattatctttgatctaccggcatcaggagaaggtgggaaggaaatgcttccggcaatgtcatcaagaggatcatcctccggcactgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26574352 |
attgagaagtgcttattatctttgatctaccggcatcaggagaaggtgggaaggaaatgcttccggcaatgtcatcaagaggatcatcctccggcactgg |
26574253 |
T |
 |
| Q |
217 |
ctcctgaatttcaagatctttgacccatgcatcgaccctcgcataagaagatgtctctgtcgaaaaagcaaaccattggttttgaaatctgctctgcctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26574252 |
ctcctgaatttcaagatctttgacccatgcatcgaccctcgcataagaagatgtctctgtcgaaaaagcaaaccattggttttgaaatctgctctgcctt |
26574153 |
T |
 |
| Q |
317 |
tg |
318 |
Q |
| |
|
|| |
|
|
| T |
26574152 |
tg |
26574151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University