View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_22 (Length: 294)
Name: NF12700_low_22
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 36053266 - 36053015
Alignment:
| Q |
18 |
agtgttttcattgtatatatcgtgtctaccttaatttcttttataacacttaacagcatgtctattagcaggaatgttatgaagccagcacgattagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36053266 |
agtgttttcattgtatatatcgtgtctaccttaatttcttttataacacttaacagcatgtctattagcaggaatgttatgaagccggcacgattagaat |
36053167 |
T |
|
| Q |
118 |
tggtatttttaaaaacaatactttttctactccctatatataaaggtccacttgggaattggccgggaattaaaacttgaatttaaaaagtgttaagaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36053166 |
tggtatttttaaaaacaatactttttctactccctatatataaaggtccacttgggaattggccgggaattaaaacttcaatttaaaaagtgttaagaag |
36053067 |
T |
|
| Q |
218 |
ttgcaaattgatgaaaatctttcatggtcaactctttctcttgagtgaatga |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36053066 |
ttgcaaattgatgaaaatctttcatggtcaactctttctcttgagtgaatga |
36053015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University