View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_26 (Length: 250)
Name: NF12700_low_26
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 29420656 - 29420901
Alignment:
| Q |
1 |
tgctcttaattaatggatgcatcatcttatttttgatnnnnnnnnnnnnttgatgcatcattttacttgaaatttgtgtttctactatgctttgttcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420656 |
tgctcttaattaatggatgcatcatcttatttttgataaaaaagaaaaattgatgcatcattttacttgaaatttgtgtttctactatgctttgttcttg |
29420755 |
T |
|
| Q |
101 |
ttagag--tatagcttaggcatattagaaaatgtatatagacttagttttaactatactttatcttgttttgcaagttgtttggtcataataggaagaac |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420756 |
ttagagagtatagcttaggcatattagaaaatgtatatagactcagttttaactatactttatcttgttttgcaagttgtttggtcataataggaagaac |
29420855 |
T |
|
| Q |
199 |
aagattcgttgttgtgcatgtggattttgtccataatctctgcttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420856 |
aagattcgttgttgtgcatgtggattttgtccataatctctgcttc |
29420901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University