View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_27 (Length: 248)
Name: NF12700_low_27
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 21150016 - 21149863
Alignment:
| Q |
1 |
ttaatgaaagagggacaatgttttt----ggagagaaaaagaagtagtataattaggtatatatatttatagaaaaagtttttagtaacaaaatttttta |
96 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21150016 |
ttaatgaaggagggacaatgtttgttttgggagagaaaaagaagtagtataattaggtatatatatttatagaaaaagtttttagtaacaaggactttta |
21149917 |
T |
|
| Q |
97 |
agtcattcataaaattcaaatgcactatttgttgttcaactttggttaactata |
150 |
Q |
| |
|
|||||||||||||||||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
21149916 |
agtcattcataaaattcaaatgcattatctattgttcaactttggttaactata |
21149863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 205
Target Start/End: Complemental strand, 21149694 - 21149631
Alignment:
| Q |
141 |
gttaactatactttgtcctgatacaatttgccactttcaaaaaatagaatatattatatgaaagt |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
21149694 |
gttaactatactttgtctgtatacaatttgccactttc-tgaaatagaatatattatttgaaagt |
21149631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University