View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_28 (Length: 246)
Name: NF12700_low_28
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 246
Target Start/End: Original strand, 29420380 - 29420612
Alignment:
| Q |
14 |
gacatcatgatgaaaatggttcctatcttgggaaaagaacgtaacaattcccacatcataatattttttgttgaaggtggggcagctgaagattaatgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420380 |
gacatcatgatgaaaatggttcctatcttgggaaaagaacgtaacaattcccacatcataatattttttgttgaaggtggggcagctgaagattaatgat |
29420479 |
T |
|
| Q |
114 |
ttgttccattgcttgttgtagaaatgtatataacaaagtaaattagtttcagctcttctgtaaagagggnnnnnnngtttcaatgccttgacctagaaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
29420480 |
ttgttccattgcttgttgtagaaatgtatataacaaagtaaattagtttcagctcttctgtaaagagggaaaaaaagtttcaatgccttgacctagaagt |
29420579 |
T |
|
| Q |
214 |
acttgtaacaccaccacatataagacaaggaaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29420580 |
acttgtaacaccaccacatataagacaaggaaa |
29420612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University