View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_29 (Length: 239)
Name: NF12700_low_29
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 6672073 - 6672284
Alignment:
| Q |
1 |
agagggtgtaagttcacatctggtcggattgtttatatagtggtggaaaatttttaggcttaatgttattcctctattatttcacaactacctatatcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6672073 |
agagggtgtaagttcacatctggtcggattgtttatatagtggtggaaaatttttaggcttaatgttattcctctattatttcacaactacctatatcag |
6672172 |
T |
 |
| Q |
101 |
aacatgcatgttagtttgtagactaactagtgactcatatattactctaaattgattcttggattacttaatagctacgaataaatggcaaaatattact |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6672173 |
aacatgcatgtgagtttgtagactaactagtgactcatatattactctaaattgattcttggattaattaatagctacgaataaatggcaacatattact |
6672272 |
T |
 |
| Q |
201 |
acttacctaaag |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6672273 |
acttacctaaag |
6672284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 6625035 - 6624983
Alignment:
| Q |
56 |
aggcttaatgttattcctctattatttcacaactacctatatcagaacatgca |
108 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
6625035 |
aggcttaatattattcctcttttacttcacaactagttatatcagaacatgca |
6624983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University