View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_34 (Length: 231)
Name: NF12700_low_34
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 44605297 - 44605085
Alignment:
| Q |
1 |
acccctccgggtaaatttctacataacaggatgaagtgtgatctcatacaaaaatggacgggtctatttctttccatcttaaatagtgcgagatttaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605297 |
acccctccgggtaaatttctacataacaggatgaagtgtgatctcatacaaaaatggatgggtctatttctttccatcttaaatagtgcgagatttaaat |
44605198 |
T |
 |
| Q |
101 |
agaagtataggacaaatgtaaaatacnnnnnnnaggaacaaatgtaaaatgatgctaatacgttttttatttctttcaacacgttattttccattgttta |
200 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44605197 |
agaagtaaaggacaaatgtaaaatactttttttaggaacaaatgtaaaatgatgctaatacgttttttatttctttcaacgcgttattttctattgttta |
44605098 |
T |
 |
| Q |
201 |
aaatgtatgagtt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44605097 |
aaatgtatgagtt |
44605085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University