View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12700_low_35 (Length: 207)
Name: NF12700_low_35
Description: NF12700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12700_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 120 - 188
Target Start/End: Complemental strand, 8455976 - 8455905
Alignment:
| Q |
120 |
aggcatttgattcatattctcttcttcttct---gttagcttagaattgcaaagcttcaatagtaagcgccc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8455976 |
aggcatttgattcatattctcttcttcttcttctgttagcttagaattgcaaagcttcaatagtaagcgccc |
8455905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University