View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12701_high_13 (Length: 322)
Name: NF12701_high_13
Description: NF12701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12701_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 13016005 - 13015703
Alignment:
| Q |
18 |
ctcgggcccctctgtggttggtgcagcttgttttgatcgtttcggttttaggatgggcctgtttgtatagattctttgggacctttccttttgctgtact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13016005 |
ctcgggcccctctgtggttggtgcagcttgttttgatcgtttcggttttaggatgggtctgtttgtatagattctttggggcctttccttttgctgtact |
13015906 |
T |
 |
| Q |
118 |
tttctgcattaatcctttcttgctgctggttttgttcagtatgcatgggatgctagccttttagcactgctggtgcgtggcttttatacaagctgattc- |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13015905 |
tttctgcattaatcctttcttgctgctggttttgttcagtatgcatgggatgctagccttttagcactgctggtgcgtggcttttatataagctgattca |
13015806 |
T |
 |
| Q |
217 |
-----nnnnnnnnnngacgccttgatcctagcattataacagtgggatttcagcttgtgttttttcctctcgtgcatcaacttgcatattatgcgtctgt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13015805 |
aaaaaaaaaaaaaatgacgccttgatcctagcattataacagtgggatttcaacttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgt |
13015706 |
T |
 |
| Q |
312 |
gct |
314 |
Q |
| |
|
||| |
|
|
| T |
13015705 |
gct |
13015703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University