View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12701_high_7 (Length: 376)
Name: NF12701_high_7
Description: NF12701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12701_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 4 - 334
Target Start/End: Original strand, 49821247 - 49821577
Alignment:
| Q |
4 |
gctcgttcactgaggattttggctggaagaaagtggcatttatatggtgttgattaacatgtattattgactagagatgtatttgtggtttgataaatat |
103 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49821247 |
gctcgttgattgaggattttggctggaagaaagtggcatttatatggtgttgattaacatgtattattgactagagatgtatttgtggtttgataaatat |
49821346 |
T |
 |
| Q |
104 |
tcaaacttgtttatttgggttcacgtagcatcaatgggtgtatgtggcgtgcactttttcaacaactccggtttgaagaacttcattgctcnnnnnnnnn |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49821347 |
tcaaacttgtttatttgggttcacgtagcatcaatgggtgtatgtggcgtgtactttttcaacaactccggtttgaagaacttcattgctcttttttttt |
49821446 |
T |
 |
| Q |
204 |
nngctttctttaagaatacctattgtgaacgaagtgctcgcattcttgcatattgcatgatgtttggaaattggagatatacttatggaggatatttggt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49821447 |
ttgctttctttaagaatacctattgtgaacgaagtgctcgcattcttgcatattgcatgatgtttggaaattggagatatacttatggaggatatttggt |
49821546 |
T |
 |
| Q |
304 |
gtttagtatcttattgagttcgaaaggtgtg |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49821547 |
gtttagtatcttattgagttcgaaaggtgtg |
49821577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University