View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12701_low_14 (Length: 335)
Name: NF12701_low_14
Description: NF12701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12701_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 254 - 326
Target Start/End: Complemental strand, 34310984 - 34310912
Alignment:
| Q |
254 |
gatgatcatccatagcacctgatgggatgattacagcccttttgagcagactgaccgtgacctcggcctttgc |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34310984 |
gatgatcatccatagcaccttatgggatgattacagcccttttgagcagactgaccgtgacctcggcctttgc |
34310912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 125 - 206
Target Start/End: Complemental strand, 34311072 - 34310990
Alignment:
| Q |
125 |
ttcatgcaaacaatgactataactcgttgtcatttattc-aaatataaaattttcaatccttaaccaccaaaacataaaaaca |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
34311072 |
ttcatgcaaacaatgactataaatcgttgtcatttattcaaaatataaaattttcaatccttaaccagcaaaatataaaaaca |
34310990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University