View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12701_low_14 (Length: 335)

Name: NF12701_low_14
Description: NF12701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12701_low_14
NF12701_low_14
[»] chr3 (2 HSPs)
chr3 (254-326)||(34310912-34310984)
chr3 (125-206)||(34310990-34311072)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 254 - 326
Target Start/End: Complemental strand, 34310984 - 34310912
Alignment:
254 gatgatcatccatagcacctgatgggatgattacagcccttttgagcagactgaccgtgacctcggcctttgc 326  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
34310984 gatgatcatccatagcaccttatgggatgattacagcccttttgagcagactgaccgtgacctcggcctttgc 34310912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 125 - 206
Target Start/End: Complemental strand, 34311072 - 34310990
Alignment:
125 ttcatgcaaacaatgactataactcgttgtcatttattc-aaatataaaattttcaatccttaaccaccaaaacataaaaaca 206  Q
    |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||    
34311072 ttcatgcaaacaatgactataaatcgttgtcatttattcaaaatataaaattttcaatccttaaccagcaaaatataaaaaca 34310990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University