View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12701_low_18 (Length: 316)
Name: NF12701_low_18
Description: NF12701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12701_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 12919935 - 12919640
Alignment:
| Q |
1 |
gattttgcattgggaaagaaatggtaattactctgtgcgttcggcttaccattcgatacaagatgacaacagtagagagaaccctgaagcttcttctatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
12919935 |
gattttgcattgggaaagaaatggtaattactctgtgcgttcggcttaccattcgatacaagatgacaacagtagagagaaccctgaagcttcatctttg |
12919836 |
T |
 |
| Q |
101 |
attgaccaaaggctttggagagcagtctggaaaatgcatgctccaaac-----tgtactagaaactttttgtggcgactggcccgcgacattctgccaac |
195 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12919835 |
agtgaccaaaggctttggagagcagactggaaaatgcatgctccaaacaggctaggactagaaactttttgtggcgactggcccgcaacattctgccaac |
12919736 |
T |
 |
| Q |
196 |
cagagggcgactggaacaaaaaggcgtgaatcttgatcctgtatgccttttatgcttctctgaaacagaaactactgaacaccttttcatgagatg |
291 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12919735 |
cagaggccgactggaacaaaaaggcgtgattcttgatcctgtatgccctttatgcttctctgaaacagaaactactgaacaccttttaatgagatg |
12919640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University