View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12702_high_2 (Length: 246)

Name: NF12702_high_2
Description: NF12702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12702_high_2
NF12702_high_2
[»] chr7 (1 HSPs)
chr7 (22-229)||(44645885-44646092)


Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 22 - 229
Target Start/End: Complemental strand, 44646092 - 44645885
Alignment:
22 aacaagtcagttcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaatggaggatcaaaatttctcctaagataaaat 121  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44646092 aacaagtcaggtcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaatggaggatcaaaatttctcctaagataaaat 44645993  T
122 ttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttggtttggctaactcaaaggtaatgaatttgac 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
44645992 ttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttggtttggctaactcgaaggtaatgaatttgac 44645893  T
222 tagcttca 229  Q
    ||||||||    
44645892 tagcttca 44645885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University