View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12702_low_2 (Length: 246)
Name: NF12702_low_2
Description: NF12702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12702_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 22 - 229
Target Start/End: Complemental strand, 44646092 - 44645885
Alignment:
| Q |
22 |
aacaagtcagttcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaatggaggatcaaaatttctcctaagataaaat |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646092 |
aacaagtcaggtcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaatggaggatcaaaatttctcctaagataaaat |
44645993 |
T |
|
| Q |
122 |
ttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttggtttggctaactcaaaggtaatgaatttgac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44645992 |
ttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttggtttggctaactcgaaggtaatgaatttgac |
44645893 |
T |
|
| Q |
222 |
tagcttca |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
44645892 |
tagcttca |
44645885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University