View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12703_high_15 (Length: 236)

Name: NF12703_high_15
Description: NF12703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12703_high_15
NF12703_high_15
[»] chr4 (1 HSPs)
chr4 (1-236)||(2794363-2794598)
[»] chr2 (1 HSPs)
chr2 (106-222)||(29261933-29262049)


Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 2794363 - 2794598
Alignment:
1 ttgatccagaaaattgtcgaaggcttgctgaagaggtgttgaaggttttgggtgaggctgatgaccgagaagtggagaagaggttgctggggtattttga 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||    
2794363 ttgatccggaaaattgtcgaaggcttgctgaagaggtgttgaaggttttgggtgaggctgatgacagagaagtggagaagaggttgttggggtattttga 2794462  T
101 tttgaataagtttagtcttgttaagtttctgatgcagaataagttgaagattgtgtggtgtactagcttggccagggcgagggatcaagaagagagggat 200  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2794463 tttgaataagtttagtcttgttaagtttctaatgcagaataagttgaagattgtgtggtgtactagcttggccagggcgagggatcaagaagagagggat 2794562  T
201 aaaattgaggaagagatgaaggggtcgaatttggag 236  Q
    ||||||||||||||||||||||||||||||||||||    
2794563 aaaattgaggaagagatgaaggggtcgaatttggag 2794598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 222
Target Start/End: Original strand, 29261933 - 29262049
Alignment:
106 ataagtttagtcttgttaagtttctgatgcagaataagttgaagattgtgtggtgtactagcttggccagggcgagggatcaagaagagagggataaaat 205  Q
    |||||||||||||| |||||||| || |||  |||| | |||| ||| ||||||||||| | ||||| |||||    ||||| |||||||| || |  ||    
29261933 ataagtttagtcttattaagtttttgttgcgaaataggctgaaaattttgtggtgtactcgtttggcgagggcacaagatcaggaagagagagagacgat 29262032  T
206 tgaggaagagatgaagg 222  Q
    |||||||||||||||||    
29262033 tgaggaagagatgaagg 29262049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University