View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12703_high_7 (Length: 380)
Name: NF12703_high_7
Description: NF12703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12703_high_7 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 188 - 380
Target Start/End: Complemental strand, 12920371 - 12920179
Alignment:
| Q |
188 |
gaacattgggttgcatatacctaagggaaaacccctccattttcgtcccaccggtgacatggacttgacagatttggaagtttaagtttgtgcttatcta |
287 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920371 |
gaacattgggttgcttatacctaagggaaaacccctccattttcgtcccaccggtgacatggacttgacagatttggaagtttaagtttgtgcttatcta |
12920272 |
T |
 |
| Q |
288 |
tttcagaaaacaaaggaacccaaacttattgaggagaggttggtgaaggccggtgaactatctgccaatagagatgaattgatgtctttactc |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12920271 |
tttcagaaaacaaaggaacccaaacttattgaggagaggttggtgaaggccggtgaactatctgccaatagagatgaattgatgtttttactc |
12920179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 12920558 - 12920437
Alignment:
| Q |
1 |
ttaacaaatatgatatggctaaacttaatatatttgtgtgctctatacagctctcacctgttgcaaagactcccactaagcctaagaggcttttccattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920558 |
ttaacaaatatgatatggctaaacttaatatatttgtgtgctctatacagctctcacctgttgcaaagactcccactaagcctaagaggcttttccattc |
12920459 |
T |
 |
| Q |
101 |
tcaatcaccccctgctagtggt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12920458 |
tcaatcaccccctgctagtggt |
12920437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University