View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12703_low_17 (Length: 236)
Name: NF12703_low_17
Description: NF12703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12703_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 229
Target Start/End: Complemental strand, 33426631 - 33426424
Alignment:
| Q |
22 |
ataccaaaggattagaaaaggaaaatgatatacattgaaaatgttgtatgtattcagtgaagcctaagtttcatatcaagatatatcagccacaacatta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33426631 |
ataccaaaggattagaaaaggaaaatgatttacattgaaaatgttgtatgtatttagtgaagcctaagtttcatatcaagatatatcagccacaacatta |
33426532 |
T |
 |
| Q |
122 |
tcttagtatatcagatttccaaaattttattctgtcagatgtatcactcacacggggacttgagcctannnnnnnnaaagagctaaatgtaacttccacg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33426531 |
tcttagtatatcagatttccaaaattttattctgtcagatgtatcactcacacgggaacttgagcctatttttttcaaagagctaaatgtaacttccacg |
33426432 |
T |
 |
| Q |
222 |
cgaaagtg |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
33426431 |
cgaaagtg |
33426424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University