View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12703_low_18 (Length: 235)

Name: NF12703_low_18
Description: NF12703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12703_low_18
NF12703_low_18
[»] chr5 (1 HSPs)
chr5 (93-133)||(5111938-5111978)


Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 93 - 133
Target Start/End: Complemental strand, 5111978 - 5111938
Alignment:
93 atggaactatattctaaagtgcagtggctaattaagataac 133  Q
    |||||||||||||||||||||||||||||||||||||||||    
5111978 atggaactatattctaaagtgcagtggctaattaagataac 5111938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University