View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12704_low_4 (Length: 298)
Name: NF12704_low_4
Description: NF12704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12704_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 3 - 281
Target Start/End: Original strand, 8435151 - 8435427
Alignment:
| Q |
3 |
tacagtttcttcgtttaattttcattgcagcgtcacatttttagatcatcgacaaatttaccattagaattatataatattgctatcattttcggccttt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8435151 |
tacagtttcttcgtttaattttcattgcagc--cacatttttagatcatcgacaaagttaccattagaattatataatattgctatcattttcggccttt |
8435248 |
T |
 |
| Q |
103 |
ggtttgtgacaaaaccgtgttgatctgtctctacaaatgtgtcggtacggtctcatatagttcaactatttctatctcttattttggacatgcctctaat |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8435249 |
ggtttgtgacaaaaccgtcttgatctgtctcttcaaatgtgtcggtacggtctcatatagttcaactatttctatctcttattttggacatgtctctaat |
8435348 |
T |
 |
| Q |
203 |
tgtcctctattggcatcttatattttttaaactgagtatatgtttataagctcgaaattaattaatgcttgatggatat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8435349 |
tgtcctctattggcatcttatattttttaaactgagtataattttataagctcgaaattaattaatgcttgatggatat |
8435427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University