View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12705_high_4 (Length: 347)
Name: NF12705_high_4
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12705_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 151 - 332
Target Start/End: Complemental strand, 20139427 - 20139246
Alignment:
| Q |
151 |
aggatttgctacatcctctatgcataaatgcgccttgcaaaatggtagaccaaagtcttaacatctttagggttgtggttttcttgggatatcctggtat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20139427 |
aggatttgctacatcctctatgcataaatgcgccttgcaaaatggtagaccaaagtcttaacatctttagggttgtggttttcttcggatatcctggtat |
20139328 |
T |
 |
| Q |
251 |
gagaacatcatacttgggcaaaatattgagatcttgtcaacaataggtgtcctgttgtagttaacatgtagtgtcgttctct |
332 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20139327 |
gagaacatcatacttgggcaaaatatcgagatcttgtcaacaataggtgtccggttgtagttaacatgtagtgtcgttctct |
20139246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 69 - 114
Target Start/End: Complemental strand, 20139758 - 20139713
Alignment:
| Q |
69 |
ttggtttcaatttagttttcttaatcattgattcattctttataga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20139758 |
ttggtttcaatttagttttcttaatcatagattcattctttataga |
20139713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University