View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12705_high_7 (Length: 267)
Name: NF12705_high_7
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12705_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 36808832 - 36809082
Alignment:
| Q |
1 |
ttattttgggatgaaagttgattgagaatcaaaatggctatggctagatgtatgatattgtggttgcttcaaatatgctggtctgattactgagtataca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36808832 |
ttattttgggatgaaagttgattgagaatcaaaatggctatggctagatgtatgatattgtggttgcttcaaatatgctggtctgattaccgagtataca |
36808931 |
T |
 |
| Q |
101 |
acacttggattaatatttcaggatatgattgagtattttttggttggtcattggtgtacacttaaactttgggatgttcctagtatagcttgttttagct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36808932 |
acacttggattaatatttcaggatatgattgagtattttttggttggtcattggtgt--acttaaactttgggatgttcctag--tagcttgttttagct |
36809027 |
T |
 |
| Q |
201 |
cttgaactgatgtatgttgtttgtcttagactcttagctctagctggtgtgatgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36809028 |
cttgaactgatgtatgttgtttgtcttagactcttagctctagctggtgtgatgt |
36809082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 136 - 236
Target Start/End: Complemental strand, 36509831 - 36509735
Alignment:
| Q |
136 |
ttttttggttggtcattggtgtacacttaaactttgggatgttcctagtatagcttgttttagctcttgaactgatgtatgttgtttgtcttagactctt |
235 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| ||||||| |||| |||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
36509831 |
ttttttggtttgccattggtgtacacttaaacttttggatgtt-ctag--tagcttgttttagctctt-aactaatgtatgttgtttgtcttagactctt |
36509736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University