View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12705_high_8 (Length: 266)
Name: NF12705_high_8
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12705_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 119 - 249
Target Start/End: Original strand, 10859940 - 10860068
Alignment:
| Q |
119 |
tataagatgtagaacttatattctttttataatttgac-aggtgaggtccaactccaataccgcagcaaaatgactggaaaatgaggttgatggtaaaga |
217 |
Q |
| |
|
|||||| |||| |||||| ||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10859940 |
tataagttgtaaaacttacattctttttataatttgactaggtgaggtccaacttcaatactgcagcaaaatgactggaaaatgaggttgatggtaaaga |
10860039 |
T |
 |
| Q |
218 |
catgagttgatggagaggaacgaagttgtcca |
249 |
Q |
| |
|
| |||||||| ||||||| ||||||||||| |
|
|
| T |
10860040 |
c---agttgatgaagaggaatgaagttgtcca |
10860068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University