View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12705_low_10 (Length: 266)

Name: NF12705_low_10
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12705_low_10
NF12705_low_10
[»] chr8 (1 HSPs)
chr8 (119-249)||(10859940-10860068)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 119 - 249
Target Start/End: Original strand, 10859940 - 10860068
Alignment:
119 tataagatgtagaacttatattctttttataatttgac-aggtgaggtccaactccaataccgcagcaaaatgactggaaaatgaggttgatggtaaaga 217  Q
    |||||| |||| |||||| ||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
10859940 tataagttgtaaaacttacattctttttataatttgactaggtgaggtccaacttcaatactgcagcaaaatgactggaaaatgaggttgatggtaaaga 10860039  T
218 catgagttgatggagaggaacgaagttgtcca 249  Q
    |   |||||||| ||||||| |||||||||||    
10860040 c---agttgatgaagaggaatgaagttgtcca 10860068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University