View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12705_low_11 (Length: 234)
Name: NF12705_low_11
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12705_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 2878469 - 2878264
Alignment:
| Q |
15 |
caaaggagaccggctttaatgatggaagagtgataatatgacttaagttgttgttcagttggaaagtacatcatcaatatttattagtagttttaataat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2878469 |
caaaggagaccggctttaatgatggaagagtgataatatgacttaagttgttgttcagttggaaagtacatcatcaatatttattagtaattttaataat |
2878370 |
T |
|
| Q |
115 |
gaaatttaatttgcaagctttggaattgcataaactataannnnnnnnnnnnntcttcattatgttcctttactatttcttttttcattttgaaaatgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2878369 |
gaaatttaatttgcaagctttggaattgcataaactataatctctttctctcttcttcattatgttcctttactatttcttttttcattttgaaaatgtt |
2878270 |
T |
|
| Q |
215 |
gcattt |
220 |
Q |
| |
|
|||||| |
|
|
| T |
2878269 |
gcattt |
2878264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University