View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12705_low_2 (Length: 384)
Name: NF12705_low_2
Description: NF12705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12705_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 44110040 - 44109984
Alignment:
| Q |
133 |
gctagaatatgttttttattcaagggtatttttgtactttcaaaagtaatcaatact |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44110040 |
gctagaatatgttttttattcaagggtatttttgtactttcaaaaataatcaatact |
44109984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 367
Target Start/End: Complemental strand, 9844132 - 9844097
Alignment:
| Q |
332 |
taaatgtgtttttagttcatacaaaatcacaagatt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9844132 |
taaatgtgtttttagttcatacaaaatcacaagatt |
9844097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 332 - 367
Target Start/End: Complemental strand, 9849790 - 9849755
Alignment:
| Q |
332 |
taaatgtgtttttagttcatacaaaatcacaagatt |
367 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9849790 |
taaatttgtttttagttcatacaaaatcacaagatt |
9849755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 133 - 185
Target Start/End: Complemental strand, 6377599 - 6377547
Alignment:
| Q |
133 |
gctagaatatgttttttattcaagggtatttttgtactttcaaaagtaatcaa |
185 |
Q |
| |
|
|||| ||||||||||| || ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
6377599 |
gctataatatgtttttaatacaagggtatttttgtacttccaaaaataatcaa |
6377547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University