View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12706_low_1 (Length: 304)
Name: NF12706_low_1
Description: NF12706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12706_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 160 - 285
Target Start/End: Complemental strand, 48705107 - 48704982
Alignment:
| Q |
160 |
gctatataacgataaaccaatgtggacaaggttgtggaggagattaaggttatgtcgtggagatgggggttaagtcggttggaaacgacggcttgcttgt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48705107 |
gctatataacgataaaccaatgtggacaaggttgtggaggagattaaggttatgtcgtggagatgggggttaagtcggttggaaacgacggcttgcttgt |
48705008 |
T |
 |
| Q |
260 |
tttatgagtggcaatggaatcctatt |
285 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48705007 |
tttatgagtggcaatggaatcctatt |
48704982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 137
Target Start/End: Complemental strand, 45364754 - 45364695
Alignment:
| Q |
78 |
tggtatatcttcttttgaaatgggaatttcttttgcctcccaataattaggatcctgttt |
137 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| |||||| ||||| ||| || |||||| |
|
|
| T |
45364754 |
tggtatatcttcttttgaagtggaaatttctttggcctcctaataactagcatactgttt |
45364695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 137
Target Start/End: Complemental strand, 45375994 - 45375935
Alignment:
| Q |
78 |
tggtatatcttcttttgaaatgggaatttcttttgcctcccaataattaggatcctgttt |
137 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| |||||| ||||| ||| || |||||| |
|
|
| T |
45375994 |
tggtatatcttcttttgaagtggaaatttctttggcctcctaataactagcatactgttt |
45375935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 137
Target Start/End: Complemental strand, 45383573 - 45383514
Alignment:
| Q |
78 |
tggtatatcttcttttgaaatgggaatttcttttgcctcccaataattaggatcctgttt |
137 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| |||||| ||||| ||| || |||||| |
|
|
| T |
45383573 |
tggtatatcttcttttgaagtggaaatttctttggcctcctaataactagcatactgttt |
45383514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 208 - 284
Target Start/End: Complemental strand, 42662051 - 42661975
Alignment:
| Q |
208 |
gttatgtcgtggagatgggggttaagtcggttggaaacgacggcttgcttgttttatgagtggcaatggaatcctat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||| | ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
42662051 |
gttatgtcgtggagatgggggttaagtcgattgcaaacgtctgcttgcttgttctatgagtggcaatggaaccctat |
42661975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 208 - 284
Target Start/End: Original strand, 50230411 - 50230487
Alignment:
| Q |
208 |
gttatgtcgtggagatgggggttaagtcggttggaaacgacggcttgcttgttttatgagtggcaatggaatcctat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||| | ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
50230411 |
gttatgtcgtggagatgggggttaagtcgattgcaaacgtctgcttgcttgttctatgagtggcaatggaaccctat |
50230487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 42660374 - 42660444
Alignment:
| Q |
208 |
gttatgtcgtggagatgggggttaagtcggttggaaacgacggcttgcttgttttatgagtggcaatggaa |
278 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| ||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
42660374 |
gttatgtcctggagatgggggttaagtcgattgcaaacgtctgcttgcttgttctatgagtggcaatggaa |
42660444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 205 - 281
Target Start/End: Complemental strand, 9210007 - 9209931
Alignment:
| Q |
205 |
aaggttatgtcgtggagatgggggttaagtcggttggaaacgacggcttgcttgttttatgagtggcaatggaatcc |
281 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||| || | |||| || ||||| ||||||||||| |||||||| |
|
|
| T |
9210007 |
aaggttctgtcgtggagatggtgtttaagtcggttgcaagggccggcgtggttgttctatgagtggcactggaatcc |
9209931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University