View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12706_low_3 (Length: 234)
Name: NF12706_low_3
Description: NF12706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12706_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 34976862 - 34977079
Alignment:
| Q |
15 |
cagagacacggatgttggacacgataaaacactgacaatgaaaataattgtaacacacatatcaatcacccagacatatcttcaatctaaagtgtttgta |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34976862 |
cagagacacggatgttggaaacgataaaacactgacaatgaaaataattgtaacacacatatcaatcacccagacatatcttcaatctaaagtgtctgta |
34976961 |
T |
 |
| Q |
115 |
cgata-----------------tacaaaaatcacatttgtgtaaataaaagatctattttaatatgatactatcattgtatagttcatttcctcctcata |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976962 |
cgataacttaaccaatacaatatacaaaaatcacatttgtgtaaataaaagatctattttaatatgatactatcattgtatagttcatttcctcctcata |
34977061 |
T |
 |
| Q |
198 |
cacagcaacatgattaaa |
215 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34977062 |
cacagcaacatgattaaa |
34977079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University