View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12708_low_5 (Length: 253)
Name: NF12708_low_5
Description: NF12708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12708_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 136 - 237
Target Start/End: Complemental strand, 48763460 - 48763359
Alignment:
| Q |
136 |
ctgacatatggtttacggtctgttattgaccgtaggaaatgcaccaatttttaggaattaaaattatatttaaacttgcaacttgcaagtgcgatttgca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763460 |
ctgacatatggtttacggtctgttattgaccgtaggaaatgcaccaatttttaggaattaaaattatatttaaacttgcaacttgcaagtgcgatttgca |
48763361 |
T |
 |
| Q |
236 |
ga |
237 |
Q |
| |
|
|| |
|
|
| T |
48763360 |
ga |
48763359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 48763595 - 48763528
Alignment:
| Q |
1 |
caccttaggcaagattctaactcgagactctctgaatcgatttgtctttttatcattagtacaaactc |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763595 |
caccttaggcaagattctaactcgagactctctgaatcgatttgtctttttatcattagtacaaactc |
48763528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University