View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12709_high_14 (Length: 270)
Name: NF12709_high_14
Description: NF12709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12709_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 38748726 - 38748963
Alignment:
| Q |
17 |
aagaaggggtgagagagttattatatagggaggagagagtgtgagttgagaaagagaaaataaaatggtgacaaggatgggaataagggatggtaagggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38748726 |
aagaaggggtgagagagttattatatagggaggagagagtgtgagttgagaaagagaaaataaaatggtgacaaggatgggaataagggatggtaagggg |
38748825 |
T |
|
| Q |
117 |
-ggtatgtggctaggtagcatttgagagtaacatgcaaaagagggtatgtggcagtttgttaattcattggggcctaatgttttggctatgtgtaattcg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38748826 |
gggtatgtggctaggtagcatttgagagtaacatgcaaaagagggtatgtggcagtttgttaattcattgggacctaatgttttggctatgtgtaattcg |
38748925 |
T |
|
| Q |
216 |
attacaagctctcaattcaacaatatccgtgccttttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38748926 |
attacaagctctcaattcaacaatatccgtgccctttt |
38748963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University