View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_high_27 (Length: 360)
Name: NF1270_high_27
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 2 - 177
Target Start/End: Complemental strand, 16951344 - 16951169
Alignment:
| Q |
2 |
gtacatgcttatgaaagctgttagatagcaagtcaataagatttagaccggggaaggagttgatgcaacaacattgaataatcgagacacatctccttcg |
101 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16951344 |
gtacatgcttatgaaaaccgttagatagcaagtcaataagatttagacaggggaagaagttgatgcaacaacattgaataatcgagacacatctccttcg |
16951245 |
T |
|
| Q |
102 |
caagagctataagccttcgatgaatgccataaagttcagcttaaaggatgtcagttgaacgctcataatataatga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16951244 |
caagagctataagccttcgatgaatgccataaagttcagcttaaaggatgtcagttgaacgctcataatataatga |
16951169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University