View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_high_28 (Length: 324)
Name: NF1270_high_28
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_high_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 97 - 324
Target Start/End: Original strand, 47452901 - 47453130
Alignment:
| Q |
97 |
atgaggatcggcgtagtctaaggatgttgcaaaagtgacttttcgtctgttccaaggcagctacaaccatgcatgagcattttgttgacatgttctactt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47452901 |
atgaggatcggcgtagtctaaggatgttgcaaaagtgacttttcgtctgttccaaggcagctacaaccatgcatgagcattttgttgacatgttctactt |
47453000 |
T |
 |
| Q |
197 |
tagcctgcattattataatatcgtggagattatttggttgatgtggaatttgtattttggcctgtagttgtgtgtaagactttac--taacatagttatt |
294 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
47453001 |
tagcctgcattattataatatcgaggagattgtttggttgatgtggaatttgtattttggcctgtagtagtgtgtaagactttactataacataggtatt |
47453100 |
T |
 |
| Q |
295 |
tgttggagaagttatgaaacaacaaaataa |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47453101 |
tgttggagaagttatgaaacaacaaaataa |
47453130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University