View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_high_35 (Length: 287)
Name: NF1270_high_35
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_high_35 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 51 - 215
Target Start/End: Original strand, 2299334 - 2299498
Alignment:
| Q |
51 |
cagtggcgattacctacagttgctcatagtactggtatacttcttgcatttttgtttttaggttgttcatctagcctttgtcgtgcttcactttttcttt |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
2299334 |
cagtggcgattacctacagttgctcatagtaatggtatacttcttgcatttttgtttttaggttgttcatctggcctttgtcgcgcttcactttttcttt |
2299433 |
T |
 |
| Q |
151 |
ggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgtggtgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
2299434 |
ggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcttctgttgtgc |
2299498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 142 - 210
Target Start/End: Original strand, 3449 - 3517
Alignment:
| Q |
142 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgt |
210 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||||||| ||||||||||||| ||||| ||||| |
|
|
| T |
3449 |
ttttgctttggagtaatatggttttgttcagctcagctgtagtaggctttcatgcagttttgcttctgt |
3517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 210
Target Start/End: Original strand, 38684349 - 38684417
Alignment:
| Q |
142 |
tttttctttggagtaatctggtttagttccgctcagctgtagcaggctttcatgcaactttgcctctgt |
210 |
Q |
| |
|
|||| |||||||||||| |||||| |||| |||||||| ||| || |||||||||| ||||| ||||| |
|
|
| T |
38684349 |
ttttgctttggagtaatatggttttgttcagctcagctatagtagactttcatgcagttttgcttctgt |
38684417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University