View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_high_47 (Length: 251)
Name: NF1270_high_47
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_high_47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 34 - 251
Target Start/End: Complemental strand, 16951596 - 16951379
Alignment:
| Q |
34 |
acatattaaatgtctaagtgacaatacatatagaagaagggaaacaactatcatcttataaagaacattcctattgcatccgctacaaggatgtccttaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16951596 |
acatattaaatgtctaagtgacaatacatatagaagaagggaaacaactatcatcttataaagaacattcctattgcatccgctacaaggatgtccttaa |
16951497 |
T |
 |
| Q |
134 |
gatccggaggaagagaagcgtgaaccaatagatcagggccggaagaaacaccgaccatgaaatcagctctttgaatgcctttatagagagtgtggatgat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16951496 |
gatccggaggaagagaagcgtgaaccaatagatcagggccggaagaaacaacgaccatgaaatcagctctttgaatgcctttatagagagtgtggatgat |
16951397 |
T |
 |
| Q |
234 |
acggaagaggcaattctc |
251 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
16951396 |
acggaagaggcaattctc |
16951379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University