View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_15 (Length: 483)
Name: NF1270_low_15
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 275
Target Start/End: Original strand, 26785269 - 26785512
Alignment:
| Q |
30 |
tgcaaatgatgaaccaatatattttgaggaatgaatgaaagagaaagctttgcaatatgctatggttgaagaactgaagacaattgaaaaaatgaaactt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26785269 |
tgcaaatgatgaaccaatatattttgaggaatgaatgaaagagaaagctttgcaatatgctatggttgaagaactgaagacaattgaaaaaatgaaactt |
26785368 |
T |
|
| Q |
130 |
ggtacttgactaagttattatagaggaagaagaaaactannnnnnngtaggttagaggatcaattagctgatatcatgacaaagctcttgaaaatagaga |
229 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26785369 |
ggtacttgactaagttat--tagaggaagaagaaaactatttttttgtaggttagaggatcaattagctgatatcatgataaagctcttgaaaatagaga |
26785466 |
T |
|
| Q |
230 |
aattcagagagatgagaacattcttaattgtagatcctttaccgga |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26785467 |
aattcagagagatgagaacattcttaattgtagatcctttaccgga |
26785512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 366 - 472
Target Start/End: Original strand, 26785569 - 26785675
Alignment:
| Q |
366 |
caaatatgagataaaaaatctaacattttcaaaacgaataaaatctacactgcggtgtagattttattgtttcacttttaagtagctatatgtaattttg |
465 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26785569 |
caaatatgagatacaaaatctaacattttcaaaacaaataaaatctacaccgcagtgtagattttattgtttcacttttaagtagctatgtgtaattttg |
26785668 |
T |
|
| Q |
466 |
tgttcat |
472 |
Q |
| |
|
||||||| |
|
|
| T |
26785669 |
tgttcat |
26785675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 402 - 433
Target Start/End: Complemental strand, 26785636 - 26785605
Alignment:
| Q |
402 |
aataaaatctacactgcggtgtagattttatt |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26785636 |
aataaaatctacactgcggtgtagattttatt |
26785605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University