View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_29 (Length: 396)
Name: NF1270_low_29
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 103 - 302
Target Start/End: Original strand, 14926341 - 14926540
Alignment:
| Q |
103 |
actgaacacaataatgaaatgtgaattggggttnnnnnnngtgtccaaataaaatccatcaccccccattgttttgcgtgaaaaagtttacacaaattta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926341 |
actgaacacaataatgaaatgtgaattggggttaaaaaaagtgtccaaataaaatccatcaccccccattgttttgcgtgaaaaagtttacacaaattta |
14926440 |
T |
|
| Q |
203 |
gcattcaaagttgtgtttgaagggtcaatatccttcttcctcaattacccaaaatatcctcctcactttccctaaacttgcatagtatcctttgtttctt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926441 |
gcattcaaagttgtgtttgaagggtcaatatccttcttcctcaattacccaaaatatcctcctcactttccctaaacttgcatagtatcctttgtttctt |
14926540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University