View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_33 (Length: 387)
Name: NF1270_low_33
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 30 - 186
Target Start/End: Original strand, 38935970 - 38936126
Alignment:
| Q |
30 |
ctaagagctatggtaggtatagtagcagaattgctttgccagagaatgtgcagtttgagaatattaaggctgaggttaaggatggtgttctttacataac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38935970 |
ctaagagctatggtaggtatagtagcagaattgctttgccagagaatgtgcagtttgagaatattaaggctgaggttaaggatggtgttctttacataac |
38936069 |
T |
 |
| Q |
130 |
cattcctaaggctactacttattccaaagtccttgatattagtgttcaatgacaatg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38936070 |
cattcctaaggctactacttattccaaagtccttgatattagtgttcaatgacaatg |
38936126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 289 - 352
Target Start/End: Original strand, 38936230 - 38936293
Alignment:
| Q |
289 |
gttgtgaggaagcctctctattatggagggaagtcacttgtgttatggcgcagctgtctctgct |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38936230 |
gttgtgaggaagcctctctattatggagggaagtcacttgtgttatggcgcagctgtctgtgct |
38936293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University