View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_39 (Length: 355)
Name: NF1270_low_39
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 52851101 - 52851426
Alignment:
| Q |
1 |
cagcaattcaaactcaggtcggttaaattagtgttgcagtttacttctacttttatcttctaggtttcgttctatcattgnnnnnnnntgtaagatgata |
100 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52851101 |
cagcaatttaaattcaggtcggttaaattagtgttgcagtttacttctacttttatcttctaggtttcgttctatcattgaaaagaaatgtaagatgata |
52851200 |
T |
|
| Q |
101 |
gtgattaaattaaagtaaatgcttcctacctatattcatcttcatcatctattcatttcttcgnnnnnnnnttcttcatcatttattcatgaacaagttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52851201 |
gtgattaaattaaagtaaatgcttcctacctatattcatcttcatcatctattcatttcttcgaaaaaaaattcttcatcatttattcatgaacaagttc |
52851300 |
T |
|
| Q |
201 |
tcatggttagttgattatttgttctaacgtacttggttatannnnnnnaacaacttgctaatttttggtgcaggcttattttttctgcttgctgtgtcgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851301 |
tcatggttagttgattatttgttctaacgtacttggttatatttttttaacaacttgctaatttttggtgcaggcttattttttctgcttgctgtgtcgt |
52851400 |
T |
|
| Q |
301 |
atgacaatgagaaaaaccctttgtcg |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52851401 |
atgacaatgagaaaaaccctttgtcg |
52851426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University