View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_47 (Length: 323)
Name: NF1270_low_47
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 103 - 301
Target Start/End: Original strand, 14926341 - 14926539
Alignment:
| Q |
103 |
actgaacacaataatgaaatgtgaattggggttnnnnnnngtgtccaaataaaatccatcaccccccattgttttgcgtgaaaaagtttacacaaattta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926341 |
actgaacacaataatgaaatgtgaattggggttaaaaaaagtgtccaaataaaatccatcaccccccattgttttgcgtgaaaaagtttacacaaattta |
14926440 |
T |
 |
| Q |
203 |
gcattcaaagttgtgtttgaagggtcaatatccttcttcctcaattacccaaaatatcctcctcactttccctaaacttgcatagtatcctttgtttct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14926441 |
gcattcaaagttgtgtttgaagggtcaatatccttcttcctcaattacccaaaatatcctcctcactttccctaaacttgcatagtatcctttgtttct |
14926539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University