View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_51 (Length: 314)
Name: NF1270_low_51
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 80 - 256
Target Start/End: Complemental strand, 33407662 - 33407484
Alignment:
| Q |
80 |
aataactaaataattagataaaatacgttgcatgcaattagataactaaccccactact--gtctttgtaatttttaccatgagaagttttggtaaaaag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33407662 |
aataactaaataattagataaaatacgttgcatgcaattagataactaaccccactactttgtctttgtaatttttaccatgagaagttttggtaaaaag |
33407563 |
T |
 |
| Q |
178 |
acaataaaatcgattatgatgatgttttgattttaccaaatttattcaccaacaaatccttgtcctatttgccaccttt |
256 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33407562 |
acaataaaatcgattctgatgatgttttgattttaccaaatttattcaccaacaaatccttgtcctatttgccaccttt |
33407484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University