View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_54 (Length: 313)
Name: NF1270_low_54
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 92 - 243
Target Start/End: Complemental strand, 36636259 - 36636107
Alignment:
| Q |
92 |
tatccaattaatttgaccaaatttggatgtgaaagctgccccaaaaatatcacttctgcctgtaaacaaagcaatcaaaaccacaactaatctaaatgct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636259 |
tatccaattaatttgaccaaatttggatgtgaaagctgccccaaaaatatcacttctgcctgtaaacaaagcaatcaaaaccacaactaatctaaatgct |
36636160 |
T |
|
| Q |
192 |
gttttc-ttacaagtttctgtctctaaatttttgtcgttattttaatattctt |
243 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36636159 |
gttttctttacaagtttctgtctctaaatttttgtcgttattttaattttctt |
36636107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 91 - 157
Target Start/End: Original strand, 10845289 - 10845355
Alignment:
| Q |
91 |
atatccaattaatttgaccaaatttggatgtgaaagctgccccaaaaatatcacttctgcctgtaaa |
157 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||||||| | ||| |||||||||||||||||| |
|
|
| T |
10845289 |
atatccaatcaattttaccaaatttggatgtcttagctgcccaagaaaaatcacttctgcctgtaaa |
10845355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University