View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_55 (Length: 313)
Name: NF1270_low_55
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 111 - 276
Target Start/End: Original strand, 3280075 - 3280236
Alignment:
| Q |
111 |
ttttccaaatagtacatgattgtttgtttgtttgttattctgtgcttttttcagttcggttggcggtggtttcgagctccagacttcctctgaaatgtgc |
210 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3280075 |
ttttacaaatagtacatgattgt----ttgtttgttattctgtgcttttttcagttcggttggcggtggtttcgagctccagacttcctctgaaatgtgc |
3280170 |
T |
|
| Q |
211 |
ttcttcatccacgaacttctccgatcccacaccgaatcactcttctcaccccaccaaggtacgact |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3280171 |
ttcttcatccactaacttctccgatcccacaccgaatcactcttctcaccccaccaaggtacgact |
3280236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University