View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1270_low_58 (Length: 307)

Name: NF1270_low_58
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1270_low_58
NF1270_low_58
[»] chr2 (2 HSPs)
chr2 (182-246)||(44967848-44967912)
chr2 (68-112)||(44967734-44967778)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 246
Target Start/End: Original strand, 44967848 - 44967912
Alignment:
182 agattgcatctgaagcttttgcctcaaaagctgctgttggtacagatactgttgtggattctgtg 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44967848 agattgcatctgaagcttttgcctcaaaagctgctgttggtacagatactgttgtggattctgtg 44967912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 44967734 - 44967778
Alignment:
68 gacagattgctgagaagattgcaactgatttgattgtagaaggtt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
44967734 gacagattgctgagaagattgcaactgatttgattgtagaaggtt 44967778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University