View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_58 (Length: 307)
Name: NF1270_low_58
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 246
Target Start/End: Original strand, 44967848 - 44967912
Alignment:
| Q |
182 |
agattgcatctgaagcttttgcctcaaaagctgctgttggtacagatactgttgtggattctgtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44967848 |
agattgcatctgaagcttttgcctcaaaagctgctgttggtacagatactgttgtggattctgtg |
44967912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 68 - 112
Target Start/End: Original strand, 44967734 - 44967778
Alignment:
| Q |
68 |
gacagattgctgagaagattgcaactgatttgattgtagaaggtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44967734 |
gacagattgctgagaagattgcaactgatttgattgtagaaggtt |
44967778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University