View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1270_low_64 (Length: 274)

Name: NF1270_low_64
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1270_low_64
NF1270_low_64
[»] chr2 (1 HSPs)
chr2 (36-222)||(6293521-6293707)


Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 36 - 222
Target Start/End: Complemental strand, 6293707 - 6293521
Alignment:
36 aatataattggcaattgataataattaaataaaataaaactaaagtttatgctcttgcaacatcttgcattgaaagaatgagatggcttttgtcccctat 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6293707 aatataattggcaattgataataattaaataaaataaaactaaagtttatgctcttgcaacatcttgcattgaaagaatgagatggcttttgtcccctat 6293608  T
136 ctacctaaataagttcagttttgtgtcaccaccacatgctaatagttagaatgtgacataatggtagggtaagtgccacttgactaa 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6293607 ctacctaaataagttcagttttgtgtcaccaccacatgctaatagttagaatgtgacataatggtagggtaagtgccacttgactaa 6293521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University