View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_67 (Length: 269)
Name: NF1270_low_67
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 55013741 - 55013993
Alignment:
| Q |
7 |
tcgaataatataggaaattgttttaattaaatctgtgaacaatactcaccagttacatcagacaaagacaattgattattactatgagtaatatttgtct |
106 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55013741 |
tcgaattatataggaaattgttttaatgaaatctgtgaacaatactcaccagttacatcagacaaagacaattgattattaccatgagtaatatttgtct |
55013840 |
T |
|
| Q |
107 |
gatggcaattcgtggaataatagtaacttagattttgacatgttaa-------ttgttacactattaattggtttggatacattgtacaggacgaattgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55013841 |
gatggcaattcgtggaataatagtaacttagattttgacatgttaattgttatttgttacactattaattggtttggatacattgtacaggacgaattgt |
55013940 |
T |
|
| Q |
200 |
tatggggtgccgcatggttaaggagggctactcaggatgaaaattacctaaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55013941 |
tatggggtgccgcatggttaaggagggctactcaggatgaaaattacctaaac |
55013993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University