View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_69 (Length: 262)
Name: NF1270_low_69
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_69 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 262
Target Start/End: Complemental strand, 55014299 - 55014066
Alignment:
| Q |
29 |
actattgatcagcatttacattaaaacaatgtcaaatatatacatttgtgcgatttcaacttattaatttaattcctctctggttgacaaaagagaagag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55014299 |
actattgatcagcatttacattaaaacaatgtcaaatatatacatttgtgcgatttcaacttattaatttaattcctctctcgttgacaaaagagaagag |
55014200 |
T |
 |
| Q |
129 |
cccgtctagctcagttggtagagcgaaagactaatgnnnnnnnagtaaaaaggcaagagttgaactgatttatttttaataaaagttgaattgaatagag |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55014199 |
cccgtttagctcagttggtagagcgaaagacttatgtttttttagtaaaaaggcaagagttgaactgatttatttttaataaaagttgaattgaatagag |
55014100 |
T |
 |
| Q |
229 |
atggaaccttggagacaagaacgttgaggccagc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55014099 |
atggaaccttggagacaagaacgttgaggccagc |
55014066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 153
Target Start/End: Complemental strand, 33332392 - 33332363
Alignment:
| Q |
124 |
aagagcccgtctagctcagttggtagagcg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33332392 |
aagagcccgtctagctcagttggtagagcg |
33332363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University