View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_83 (Length: 235)
Name: NF1270_low_83
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 36345367 - 36345219
Alignment:
| Q |
1 |
ttcaacccaaccttctatatcattctcaccatttcctccaaagtgtcttccaccacacaaccttgcaatcattcctgcaatcacacctactatagtgatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36345367 |
ttcaacccaaccttctatatcattctcaccatttcctccaaagtgtcttccaccacacaaccttgcaatcattccagcaatcacacctactatagtgatc |
36345268 |
T |
|
| Q |
101 |
actgctatcaccactatcaatgtctcaattgatcgatgtgaataacgat |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36345267 |
actgctatcaccactatcaatgtctcaattgatcgatgtgaataacgat |
36345219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University