View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_9 (Length: 527)
Name: NF1270_low_9
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 94 - 359
Target Start/End: Original strand, 35899715 - 35899981
Alignment:
| Q |
94 |
ctaacaaacccctcgggtctgaagacttaacaaggtccttggtgttgataaaacgatcctcgttaaatgggtttccctcaagtcgtatagaacgtttccg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899715 |
ctaacaaacccctcgggtctgaagacttaacaaggtccttggtgttgataaaacgatcctcgttaaatgggtttccctcaagtcgtatagaacgtttcca |
35899814 |
T |
 |
| Q |
194 |
tgctcatccacacaggtataaggcgtttcctctgcctaaacaagccttcgcttgctgctttactatggatgctgtcaaaatacttgcctctggctttgat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35899815 |
tgctcatccacacaggtataaggcgtttcctctgcctaaacaagccttcgcttgctgctttactatggatgctatcaaaatacttgcctctggctttgat |
35899914 |
T |
 |
| Q |
294 |
tgtccatgtttgcatgttccaatactctta-ggcgtgtcgcaagttgctttttgaagggtattttaa |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899915 |
tgtccatgtttgcatgttccaatactcttacggcgtgtcgcaagttgctttttgaagggtattttaa |
35899981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 456 - 519
Target Start/End: Original strand, 35900078 - 35900141
Alignment:
| Q |
456 |
gacttaacaccctccaaaaccctctaaaaccctactcacaaacacacccttaggcatattcttc |
519 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35900078 |
gacttaacaccctccaaaaccctctaaaatcctactcgcaaacacacccttaggcatattcttc |
35900141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 236 - 293
Target Start/End: Original strand, 35882031 - 35882088
Alignment:
| Q |
236 |
agccttcgcttgctgctttactatggatgctgtcaaaatacttgcctctggctttgat |
293 |
Q |
| |
|
||||||| |||||||||| |||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
35882031 |
agccttcacttgctgcttaactatggaggctgtcaaaatactcgcctatggctttgat |
35882088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 222 - 292
Target Start/End: Complemental strand, 10212221 - 10212151
Alignment:
| Q |
222 |
cctctgcctaaacaagccttcgcttgctgctttactatggatgctgtcaaaatacttgcctctggctttga |
292 |
Q |
| |
|
|||||||||||||||| |||| | || |||||||||||||||| ||||||||| || || ||||||||||| |
|
|
| T |
10212221 |
cctctgcctaaacaaggcttcacatgttgctttactatggatggtgtcaaaatcctcgcttctggctttga |
10212151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University