View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270_low_96 (Length: 209)
Name: NF1270_low_96
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 2987151 - 2987273
Alignment:
| Q |
1 |
aaaaatgaaccaagagaagaggatttcagttagattcacgacaacagaggatttcatagacgaaggatgaatggtgttgtcgctgccatccattcaagga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
2987151 |
aaaaatgaaccaagaggagaggatttcagttagattcacgacgacagaggatttcgtagacgaaggatgaaaggtgttgtcgctgccatcctttcaagga |
2987250 |
T |
 |
| Q |
101 |
atgtaagaggcttatcactctct |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2987251 |
atgtaagaggcttatcactctct |
2987273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 45117226 - 45117104
Alignment:
| Q |
1 |
aaaaatgaaccaagagaagaggatttcagttagattcacgacaacagaggatttcatagacgaaggatgaatggtgttgtcgctgccatccattcaagga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
45117226 |
aaaaatgaaccaagaggagaggatttcagttagattcacgacgacagaggatttcatagacgaaggatgaaaggtgttgtcgctgccatcctttcaagga |
45117127 |
T |
 |
| Q |
101 |
atgtaagaggcttatcactctct |
123 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
45117126 |
atgtaagaggctcatcactctct |
45117104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 26721683 - 26721805
Alignment:
| Q |
1 |
aaaaatgaaccaagagaagaggatttcagttagattcacgacaacagaggatttcatagacgaaggatgaatggtgttgtcgctgccatccattcaagga |
100 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
26721683 |
aaaaatgaaccaaaaggagaggatttcagttagattcacgacgacagaggatttcatagacgaaggatgaatggtgttgtcgctgctatcctttcaagga |
26721782 |
T |
 |
| Q |
101 |
atgtaagaggcttatcactctct |
123 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
26721783 |
atgttagaggcttatcactctct |
26721805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University