View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271-7-Insertion-7 (Length: 85)
Name: NF1271-7-Insertion-7
Description: NF1271-7
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271-7-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 55388745 - 55388693
Alignment:
| Q |
8 |
atatgtatatcctatatggtatagtgcacatcacatctttatgaagtgtattg |
60 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55388745 |
atatgtatatcctatatggtataatgcacatcacatctttatgaagtgtattg |
55388693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University